Ready-To-Go™ You-Prime First-Strand beads are preformulated, single-dose reaction beads prepackaged in thin-walled 0,5 ml tubes compatible with most thermal cyclers. Ready-To-Go™ You-Prime First-Strand beads are used for synthesis of first-strand cDNA templates from total RNA or polyadenylated RNA using a primer of choice.
- Pre-dispensed, single-dose reaction beads minimise pipetting errors, avoid cross-contamination, and ensure optimal performance
- First-strand reaction beads contain no primer, thus allowing users to select a first-strand primer of choice
- Highly suitable for research applications that use PCR to detect and quantify eukaryotic RNA from a variety of samples
- Reaction beads are function tested for first-strand synthesis of cDNA up to 7,5 kb and in RT-PCR from blood samples
Completed reactions (33µL final volume) can be used in PCR after adding water, Taq DNA polymerase, and primers; first-strand cDNA can also be used as a template for traditional Gubler-Hoffman second-strand cDNA synthesis.
Ordering information: First-strand reaction mix (50 white tubes): Two beads containing reaction buffer, dATP, dCTP, dGTP,dTTP, Murine reverse transcriptase (FPLCpure), RNAguard™ (porcine), RNase/DNase-free BSA.
Control mix bead (5 red tubes): One ambient-temperature-stable bead containing rabbit globin mRNA (1 ng), buffer and 8 pmol each of 5’-specific globin primer (5’d[ACACTTCTGGTCCAGTCCGACTGAG]-3’) and 3’-specific globin primer (5’-d[GCCACTCACTCAGACTTTATTCAAA]-3’).